View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11901_low_61 (Length: 234)
Name: NF11901_low_61
Description: NF11901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11901_low_61 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 15 - 218
Target Start/End: Complemental strand, 3447699 - 3447495
Alignment:
| Q |
15 |
caaaggtgattttagaggtctctaagccacaaaacagggattatccaaaagcatcacacaatccacttcggttgaaatcaatttgaggagtctaaaatgt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
3447699 |
caaaggtgattttagaggtctctaagccacaaaacatggattattcaaaagcatcacacaatccacttcggttgagatcaatttgacgagtctaaaatgt |
3447600 |
T |
 |
| Q |
115 |
aaaatctaatacataggctatcctcaaaattgatttcaaccg-aacaggtagcttgatgctttgatataacaactgaattttgattgttttgagtgcact |
213 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3447599 |
aaaatctaatacttaggctatcctcaaaattgatttcaaccgaaacaggtagcttgatgctttgatataacaactgaattttgattgttttgagtgcact |
3447500 |
T |
 |
| Q |
214 |
ttatg |
218 |
Q |
| |
|
||||| |
|
|
| T |
3447499 |
ttatg |
3447495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University