View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11901_low_64 (Length: 228)

Name: NF11901_low_64
Description: NF11901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11901_low_64
NF11901_low_64
[»] chr4 (1 HSPs)
chr4 (118-228)||(55484752-55484862)


Alignment Details
Target: chr4 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 118 - 228
Target Start/End: Complemental strand, 55484862 - 55484752
Alignment:
118 gaaagtccgaggcgattgtcttggtggccttaccttaccggccatggcatatgcatgatgttcaatatctatattatgacgtaagagcaacatgataatt 217  Q
    ||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55484862 gaaagtctgaggcgattgtcttggtggccttaccttaccgggcatggcatatgcatgatgttcaatatctatattatgacgtaagagcaacatgataatt 55484763  T
218 tagaataaaaa 228  Q
    ||||| |||||    
55484762 tagaagaaaaa 55484752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University