View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11901_low_67 (Length: 224)
Name: NF11901_low_67
Description: NF11901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11901_low_67 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 22 - 204
Target Start/End: Complemental strand, 7158259 - 7158077
Alignment:
| Q |
22 |
agatataaaagaaaagagtattggtgcaggaggaggaaaagaggaaaataacgggagctacctgatccgtggagaagaagatgtaaggacatctaagcaa |
121 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7158259 |
agatataaaagaaaagagtattggtacaggaagaggaaaagaggaaaataacgggagttacctgatccgtggagaagaagatgtaaggacatctaagcaa |
7158160 |
T |
 |
| Q |
122 |
tttttgccagggatgtattcgtgagtctggtgaccagtacttatcttccacgaccatttaggctaatggttcaattaagaagt |
204 |
Q |
| |
|
||||| | ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7158159 |
ttttttctagggatgtattggtgagtctggtgaccagtacttatcttccacggccatttaggctaatggttcaattaagaagt |
7158077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University