View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11901_low_67 (Length: 224)

Name: NF11901_low_67
Description: NF11901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11901_low_67
NF11901_low_67
[»] chr2 (1 HSPs)
chr2 (22-204)||(7158077-7158259)


Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 22 - 204
Target Start/End: Complemental strand, 7158259 - 7158077
Alignment:
22 agatataaaagaaaagagtattggtgcaggaggaggaaaagaggaaaataacgggagctacctgatccgtggagaagaagatgtaaggacatctaagcaa 121  Q
    ||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
7158259 agatataaaagaaaagagtattggtacaggaagaggaaaagaggaaaataacgggagttacctgatccgtggagaagaagatgtaaggacatctaagcaa 7158160  T
122 tttttgccagggatgtattcgtgagtctggtgaccagtacttatcttccacgaccatttaggctaatggttcaattaagaagt 204  Q
    ||||| | ||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
7158159 ttttttctagggatgtattggtgagtctggtgaccagtacttatcttccacggccatttaggctaatggttcaattaagaagt 7158077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University