View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11902_high_20 (Length: 420)
Name: NF11902_high_20
Description: NF11902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11902_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 3e-89; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 3e-89
Query Start/End: Original strand, 219 - 406
Target Start/End: Original strand, 2170032 - 2170219
Alignment:
| Q |
219 |
ctagaagcccaaatttgcagtgcagattcacaactaataatggtaaattttggctacaacagaatcttttcattctcccttgccttcttactttaaataa |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2170032 |
ctagaagcccaaatttgcagtgcagattcacaactaataatggtaaattttggctacaacagaatcttttcattctcccttgccttcttactttaaataa |
2170131 |
T |
 |
| Q |
319 |
ataataagatgattactactgcttaatacccccagtataataaaaccacataacactaaccnnnnnnngagtagcaagaattgaactt |
406 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2170132 |
ataataagatgattactactgcttaatacccccagtataataaaaccacataacactaacctttttttgagtagcaagaattgaactt |
2170219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 2166497 - 2166589
Alignment:
| Q |
19 |
agatgctgatagtatgcacgctcgcactaacttcattttttagggttgcaaactttttgttttaaaaagttaaattaacctacttagattagt |
111 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2166497 |
agatgctgagagtatgcacgctcgcactaacttcattttttagggttgcaaattttttgttttaaaaagttaaattaacctacctagattagt |
2166589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University