View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11902_high_26 (Length: 335)
Name: NF11902_high_26
Description: NF11902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11902_high_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 262; Significance: 1e-146; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 17 - 322
Target Start/End: Original strand, 49691145 - 49691450
Alignment:
| Q |
17 |
attaggctttgcactttccggtaacccatttccctttttaactaatgaaattacctttcagttccaatcttcatatgactgtcaacagtgtcataaccat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49691145 |
attaggctttgcactttccggtaacccatttccctttttaactaatgaaattacctttcagttccaatcttcatatgactgtcaacagtgtcataaccat |
49691244 |
T |
 |
| Q |
117 |
taccatgatnnnnnnnntcattgtcatgttgacagcaaaggacaaatttattgcgtcgcaaggtaatacattaacaaaacatacagaaacagtttaagac |
216 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
49691245 |
taccatgataaaaaaaatcattgtcatgttgacagcaacggacaaatttattgcgtcgcaaggtaatgcattaacaaaacatacaggaacagtttaagac |
49691344 |
T |
 |
| Q |
217 |
attacatggatcattagagttttgcttactatttcctatttgaattattgttatgcaggaagggtagaagtccagctcggaagctaggattggttttagg |
316 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49691345 |
attacatcgatcattagagttttgcttactatttcctatttgaattattattatgcaggaagggtagaagtccagctcggaagctaggattggttttagg |
49691444 |
T |
 |
| Q |
317 |
tgatgt |
322 |
Q |
| |
|
|||||| |
|
|
| T |
49691445 |
tgatgt |
49691450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 136 - 266
Target Start/End: Original strand, 49679624 - 49679753
Alignment:
| Q |
136 |
attgtcatgttgacagcaaaggacaaatttattgcgtcgcaaggtaatacattaacaaaacatacagaaacagtttaagacattacatggatcattagag |
235 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||| ||||||||||| | |||||||||| |||||||||| |||| || |||||||||||||||||| |
|
|
| T |
49679624 |
attgtcgtgttgacagaaaaggacaaatttattgccccgcaaggtaatgcgttaacaaaacttacagaaaca-tttacgatattacatggatcattagaa |
49679722 |
T |
 |
| Q |
236 |
ttttgcttactatttcctatttgaattattg |
266 |
Q |
| |
|
||||||| |||| |||||||||||||||||| |
|
|
| T |
49679723 |
ttttgctaactacttcctatttgaattattg |
49679753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 17 - 107
Target Start/End: Original strand, 49686879 - 49686969
Alignment:
| Q |
17 |
attaggctttgcactttccggtaacccatttccctttttaactaatgaaattacctttcagttccaatcttcatatgactgtcaacagtgt |
107 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||| || ||| || |||||||||||||| | ||| ||||||||||| | |||| ||||||| |
|
|
| T |
49686879 |
attaggttttgcactttctggtaacccatttcgattgttagctgatgaaattacctttaatttcaaatcttcatattattgtcgacagtgt |
49686969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 17 - 92
Target Start/End: Original strand, 49679511 - 49679586
Alignment:
| Q |
17 |
attaggctttgcactttccggtaacccatttccctttttaactaatgaaattacctttcagttccaatcttcatat |
92 |
Q |
| |
|
||||||||||||||||||||| || |||||||| || ||| | || |||| |||||||||||| || |||||||| |
|
|
| T |
49679511 |
attaggctttgcactttccggcaatccatttccattcttagatgatcaaataacctttcagttcaaaccttcatat |
49679586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 267 - 322
Target Start/End: Original strand, 49680376 - 49680431
Alignment:
| Q |
267 |
ttatgcaggaagggtagaagtccagctcggaagctaggattggttttaggtgatgt |
322 |
Q |
| |
|
|||||||||| |||||||||| || || |||||||| |||||||||||||||||| |
|
|
| T |
49680376 |
ttatgcaggaggggtagaagttcaacttggaagctaatattggttttaggtgatgt |
49680431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University