View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11902_high_43 (Length: 235)
Name: NF11902_high_43
Description: NF11902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11902_high_43 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 9 - 235
Target Start/End: Complemental strand, 31974316 - 31974090
Alignment:
| Q |
9 |
atcagtttaagcatcaacaactcgacacccagcatgcatattcgtacttgcttgttctctggctcaatcttctctctagctttaatttatgagcacatat |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31974316 |
atcagtttaagcatcaacaactcgacacccagcatgcatattcgtacttgcttgttctctggctcgatcttctctctagctttaatttatgagcacatat |
31974217 |
T |
 |
| Q |
109 |
aatattaatattttcaataatattcatttcaattaccactgggattcggaaaattatactatcaagatatacaggaagatctcaacatgattgatgctga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31974216 |
aatattaatattttcaataatattcatttcaattaccactgggattcggaaaattatactatcaagatatacaggaagatctcaacatgattgatgctga |
31974117 |
T |
 |
| Q |
209 |
atataattatatatagattgcacttac |
235 |
Q |
| |
|
||||| ||||||||||||| ||||||| |
|
|
| T |
31974116 |
atatagttatatatagattacacttac |
31974090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University