View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11902_high_46 (Length: 212)

Name: NF11902_high_46
Description: NF11902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11902_high_46
NF11902_high_46
[»] chr1 (1 HSPs)
chr1 (39-195)||(15167892-15168048)


Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 39 - 195
Target Start/End: Complemental strand, 15168048 - 15167892
Alignment:
39 aaaaggcttaaataagttagagtacctttcgttagcaacccatactaatttgtttctacaaaatcaaaattgcatgtgctgtttgtttccatctgaaaaa 138  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15168048 aaaaggcttaaataagttagagtacctttcgttagcaacccatactaatttgtttctacaaaatcaaaattgcatgtgctgtttgtttccatctgaaaaa 15167949  T
139 agtatatgatcaatcaggagtgttattgggtatattcttggaatggcaggatcatca 195  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15167948 agtatatgatcaatcaggagtgttattgggtatattcttggaatggcaggatcatca 15167892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University