View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11902_low_33 (Length: 263)
Name: NF11902_low_33
Description: NF11902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11902_low_33 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 1 - 174
Target Start/End: Complemental strand, 4396371 - 4396198
Alignment:
| Q |
1 |
atcaaacaaaacacataaaatctgataacttgtaaaattatattcagcttatttataatttaatgataaataaatcagatataacgagtcatattgattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4396371 |
atcaaacaaaacacataaaatctgataacttgtaaaattatattcagcttatttataatttaatgataaataaatcagatataacgagtcatattgattt |
4396272 |
T |
|
| Q |
101 |
aatgataaataaatttgttttcgattatcatgtgtagcttaacacactattgtttgggagtcttttggtaacca |
174 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
4396271 |
aatcataaataaatttgttttcgattatcatgtgtagcttagcacactcttgtttgggagtcttttggtaacca |
4396198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 203 - 256
Target Start/End: Complemental strand, 4396169 - 4396115
Alignment:
| Q |
203 |
gggtgatcagcttgaccttgatcatttgatgtaactatattc-ttttccttgttc |
256 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
4396169 |
gggtgatcaacttgaccttgatcatttgatgtaactatattcgttttcctagttc |
4396115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University