View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11902_low_38 (Length: 250)
Name: NF11902_low_38
Description: NF11902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11902_low_38 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 68 - 167
Target Start/End: Original strand, 27813172 - 27813271
Alignment:
| Q |
68 |
aatcagctaacccttaaaacaagtaaagacttaatcacactaagaagcaccaaacatttattgcaacagatataacaaaattaatagatgtgcatgaaac |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27813172 |
aatcagctaacccttaaaacaagtaaagacttaatcacactaagaagcaccaaacatttattgcaacagatataacaaaattaatagatgtgcatgaaac |
27813271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 75 - 240
Target Start/End: Original strand, 3248107 - 3248281
Alignment:
| Q |
75 |
taacccttaaaacaagtaaagacttaatcacactaagaagcaccaaaca-tttattgcaacagatataacaaaattaatagatgtgcatgaaacacacaa |
173 |
Q |
| |
|
|||| |||||||||||||||||| |||||| |||||||||||| ||| | ||||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
3248107 |
taacacttaaaacaagtaaagacgtaatcaaactaagaagcactaaataatttattgcaacagatataacaaaattaattgatgtccatgaaacacacaa |
3248206 |
T |
 |
| Q |
174 |
aaagggtgttcgatgtcaga--------aaaccttttgcaattctcggattcctttcgtatgtccttgtttctgt |
240 |
Q |
| |
|
||||||||| |||| || | ||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3248207 |
caagggtgtttgatgacaaattgacgacaaaccttttgcaattctcggattcctttcgtatgttcttgtttctgt |
3248281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University