View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11902_low_39 (Length: 244)
Name: NF11902_low_39
Description: NF11902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11902_low_39 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 20 - 229
Target Start/End: Original strand, 4396380 - 4396591
Alignment:
| Q |
20 |
ggtgtcaacctgttagtgtatgg--catttaaaagcgtatgtagttaacgtgaatcagaaaggtctgacccaaaacggaatggtaccaacgttttcacac |
117 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4396380 |
ggtgtcaacttgttagtgtatggggcatttaaaagcgtatgtagttaacatgaatcagaaaggtctgacccaaaacggaatggtaccaacgttttcacac |
4396479 |
T |
|
| Q |
118 |
aaactgccaaaatttgtcttcacatgaggnnnnnnnnncactttgttactatgtatgtgttcacaaatcatttctcaaaaaacaatacaactcaatagtc |
217 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4396480 |
aaactgccaaaatttgtcttcatatgaggaaaaaaaaacactttgttactatgtatgtgttcacaaatcatttctcaaaaaacaatacaactcaatagtc |
4396579 |
T |
|
| Q |
218 |
actgttcctttc |
229 |
Q |
| |
|
|||||||||||| |
|
|
| T |
4396580 |
actgttcctttc |
4396591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University