View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11902_low_40 (Length: 244)
Name: NF11902_low_40
Description: NF11902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11902_low_40 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 154 - 244
Target Start/End: Original strand, 15203965 - 15204056
Alignment:
| Q |
154 |
atgtttatc-aaacagggtcttagtcaattcatattcataaactcaaaccaaatgaattcatgaataaactattaatttgagagcaacccat |
244 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15203965 |
atgtttatccaaacagggtcttagtcaattcatattcataaactcaaaccgaatgaattcatgaataaactattaatttgagagcaacccat |
15204056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 127 - 198
Target Start/End: Original strand, 15203810 - 15203884
Alignment:
| Q |
127 |
ttcaaagtttataagcac---ttaattaagatgtttatc-aaacagggtcttagtcaattcatattcataaactca |
198 |
Q |
| |
|
||||| |||||||||||| ||||||||| |||||||| ||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
15203810 |
ttcaaggtttataagcacaacttaattaagttgtttatccaaaaagggtctg-gtcaattcatattcataaactca |
15203884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University