View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11902_low_44 (Length: 235)

Name: NF11902_low_44
Description: NF11902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11902_low_44
NF11902_low_44
[»] chr1 (1 HSPs)
chr1 (9-235)||(31974090-31974316)


Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 9 - 235
Target Start/End: Complemental strand, 31974316 - 31974090
Alignment:
9 atcagtttaagcatcaacaactcgacacccagcatgcatattcgtacttgcttgttctctggctcaatcttctctctagctttaatttatgagcacatat 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
31974316 atcagtttaagcatcaacaactcgacacccagcatgcatattcgtacttgcttgttctctggctcgatcttctctctagctttaatttatgagcacatat 31974217  T
109 aatattaatattttcaataatattcatttcaattaccactgggattcggaaaattatactatcaagatatacaggaagatctcaacatgattgatgctga 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31974216 aatattaatattttcaataatattcatttcaattaccactgggattcggaaaattatactatcaagatatacaggaagatctcaacatgattgatgctga 31974117  T
209 atataattatatatagattgcacttac 235  Q
    ||||| ||||||||||||| |||||||    
31974116 atatagttatatatagattacacttac 31974090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University