View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11902_low_47 (Length: 212)
Name: NF11902_low_47
Description: NF11902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11902_low_47 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 39 - 195
Target Start/End: Complemental strand, 15168048 - 15167892
Alignment:
| Q |
39 |
aaaaggcttaaataagttagagtacctttcgttagcaacccatactaatttgtttctacaaaatcaaaattgcatgtgctgtttgtttccatctgaaaaa |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15168048 |
aaaaggcttaaataagttagagtacctttcgttagcaacccatactaatttgtttctacaaaatcaaaattgcatgtgctgtttgtttccatctgaaaaa |
15167949 |
T |
 |
| Q |
139 |
agtatatgatcaatcaggagtgttattgggtatattcttggaatggcaggatcatca |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15167948 |
agtatatgatcaatcaggagtgttattgggtatattcttggaatggcaggatcatca |
15167892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University