View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11903_high_4 (Length: 518)
Name: NF11903_high_4
Description: NF11903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11903_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 459; Significance: 0; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 459; E-Value: 0
Query Start/End: Original strand, 18 - 516
Target Start/End: Original strand, 2530651 - 2531149
Alignment:
| Q |
18 |
ggtaagagtttcattttgagcgaactggttaaatttgatgaggctgcgggtatagctgtgcttgataaggatgctgcagaaagcggtttggaattgatgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2530651 |
ggtaagagtttcattttgagcgaactggttaaatttgatgaggctgcgggtatagctgtgctcgataaggatgctgcagaaagcggtttggaattgatga |
2530750 |
T |
 |
| Q |
118 |
gggagtcagatagggttgagttggaggagaggtggaagaagttgcaggctgccgagatggatgtgtttttgaatcgcgctgaggtggttagggagcagac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2530751 |
gggagtcagatagggttgagttggaggagaggtggaagaagttgcaggctgccgagatggatgtgtttttgaatcgcgctgaggtggttagggagcagac |
2530850 |
T |
 |
| Q |
218 |
tagattgacaatgcaggaactcaagaagaaatcaagcaaatagggttctctttcttaggtatagttttgtggctaatgtgataaatgctttggatatgtt |
317 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2530851 |
tagattggcaatgcaggaactcaagaagaaatcaagcacatagggttctctttcttaggtatagttttgtggctaatgtgataaatgttttggatatgtt |
2530950 |
T |
 |
| Q |
318 |
atctgtttatttttgtagtgattgaggctgtcttatgattgttggatttacaacattgtgctgtttgattgctgatgactatgaaattatcgtagtttag |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2530951 |
atctgtttatttttgtagtgattgaggctgtcttatgattgttggatttataacattgtgttgtttgattgctgatgactatgaaattatcgtggtttag |
2531050 |
T |
 |
| Q |
418 |
aaattccatatattctcttgctgaacatatacacattgtgttgttttgatgattgtagtattgttataccaatatatttgtgtatgcggttatagatag |
516 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2531051 |
aaattccatatattctcttgctgaacatatactcattgtgttgttttgatgattgtagtattgttataccaatatatttgtgtatgcggttataaatag |
2531149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 327 - 422
Target Start/End: Original strand, 2532115 - 2532210
Alignment:
| Q |
327 |
tttttgtagtgattgaggctgtcttatgattgttggatttacaacattgtgctgtttgattgctgatgactatgaaattatcgtagtttagaaatt |
422 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
2532115 |
tttttgtagtgattgaggctgtcttatgattgttggatttacaacattgtgttgtttgattgctgatgactatgaaattatgatggtttagaaatt |
2532210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University