View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11903_low_17 (Length: 254)
Name: NF11903_low_17
Description: NF11903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11903_low_17 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 24 - 254
Target Start/End: Original strand, 53126624 - 53126854
Alignment:
| Q |
24 |
gcatcataaaccaagcttattaatcaaatgactaaaatatcattggaacggttatctgctgtatcagatagagtaaaatatcagatcagatcacctttta |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53126624 |
gcatcataaaccaagcttattaatcaaatgactaaaatatcattggaacggttatctgctgtatcagatagagtaaaatatcagatcagatcacctttta |
53126723 |
T |
 |
| Q |
124 |
atccaatatcttaacttttttactaatgttcatatttgttaatcaactgcaaactatgacaatgaattatttatttatttttctcaatttcaacaaagga |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53126724 |
atccaatatcttaacttttttactaatgttcatatttgttaatcaactgtaaactatgacaatgaattatttatttatttttctcaatttcaacaaagga |
53126823 |
T |
 |
| Q |
224 |
aaaggggttacaaccggcgtttgaataaaaa |
254 |
Q |
| |
|
||||||||||||||| || |||||||||||| |
|
|
| T |
53126824 |
aaaggggttacaacccgcttttgaataaaaa |
53126854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 105 - 146
Target Start/End: Original strand, 53108913 - 53108954
Alignment:
| Q |
105 |
cagatcagatcaccttttaatccaatatcttaacttttttac |
146 |
Q |
| |
|
||||||||||||| |||||||||||| ||| ||||||||||| |
|
|
| T |
53108913 |
cagatcagatcacattttaatccaatttctgaacttttttac |
53108954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University