View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11903_low_21 (Length: 224)
Name: NF11903_low_21
Description: NF11903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11903_low_21 |
 |  |
|
| [»] scaffold0883 (1 HSPs) |
 |  |  |
|
| [»] scaffold0095 (1 HSPs) |
 |  |  |
|
| [»] scaffold0206 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 66; Significance: 2e-29; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 28462780 - 28462703
Alignment:
| Q |
1 |
attttgcttctaaattaatattggacttgatcttaacatggaatttttgttttatgaattgatgattaactactttgc |
78 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28462780 |
attttgtttctaaattcatattggacttgatcttaacatggaatttttgttttatcaattgatgattaactactttgc |
28462703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 164 - 201
Target Start/End: Original strand, 25950829 - 25950866
Alignment:
| Q |
164 |
aatattacctccgttcttaattataagacctttttgag |
201 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
25950829 |
aatactacctccgtccttaattataagacctttttgag |
25950866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 201
Target Start/End: Complemental strand, 4408824 - 4408780
Alignment:
| Q |
157 |
aatgcataatattacctccgttcttaattataagacctttttgag |
201 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4408824 |
aatgcataatactacctccgttcttaattataagacctttttgag |
4408780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 169 - 200
Target Start/End: Complemental strand, 30830376 - 30830345
Alignment:
| Q |
169 |
tacctccgttcttaattataagacctttttga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
30830376 |
tacctccgttcttaattataagacctttttga |
30830345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0883 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0883
Description:
Target: scaffold0883; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 200
Target Start/End: Original strand, 1720 - 1754
Alignment:
| Q |
166 |
tattacctccgttcttaattataagacctttttga |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
1720 |
tattacctccgtccttaattataagacctttttga |
1754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0095 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0095
Description:
Target: scaffold0095; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 200
Target Start/End: Original strand, 45513 - 45547
Alignment:
| Q |
166 |
tattacctccgttcttaattataagacctttttga |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
45513 |
tattacctccgtccttaattataagacctttttga |
45547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 200
Target Start/End: Original strand, 39406559 - 39406593
Alignment:
| Q |
166 |
tattacctccgttcttaattataagacctttttga |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
39406559 |
tattacctccgtccttaattataagacctttttga |
39406593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 97 - 154
Target Start/End: Original strand, 20035129 - 20035186
Alignment:
| Q |
97 |
gagacaaatatagagatgctaacatcaatgacatatccatatacatttgcgtataaat |
154 |
Q |
| |
|
|||||||| |||||||| | ||||||||||||||||| |||||| |||| | |||||| |
|
|
| T |
20035129 |
gagacaaaaatagagatccaaacatcaatgacatatcaatatacgtttgtgcataaat |
20035186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 163 - 201
Target Start/End: Complemental strand, 24073166 - 24073128
Alignment:
| Q |
163 |
taatattacctccgttcttaattataagacctttttgag |
201 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
24073166 |
taatactacctccgtccttaattataagacctttttgag |
24073128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 165 - 201
Target Start/End: Complemental strand, 52850492 - 52850456
Alignment:
| Q |
165 |
atattacctccgttcttaattataagacctttttgag |
201 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
52850492 |
atattacctccgtccttaattataagatctttttgag |
52850456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0206 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0206
Description:
Target: scaffold0206; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 97 - 154
Target Start/End: Original strand, 7059 - 7116
Alignment:
| Q |
97 |
gagacaaatatagagatgctaacatcaatgacatatccatatacatttgcgtataaat |
154 |
Q |
| |
|
|||||||| |||||||| | ||||||||||||||||| |||||| |||| | |||||| |
|
|
| T |
7059 |
gagacaaaaatagagatccaaacatcaatgacatatcaatatacgtttgtgcataaat |
7116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 162 - 198
Target Start/End: Complemental strand, 32153835 - 32153799
Alignment:
| Q |
162 |
ataatattacctccgttcttaattataagaccttttt |
198 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
32153835 |
ataatactacctccgtccttaattataagaccttttt |
32153799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University