View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11903_low_23 (Length: 209)
Name: NF11903_low_23
Description: NF11903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11903_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 18 - 194
Target Start/End: Complemental strand, 44542635 - 44542459
Alignment:
| Q |
18 |
aacctttacgccgtgattgcggttgcagacagcgatttaaaacattcttttattaataattatgtccttccttttgtcatgttcaattacataaaatttc |
117 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44542635 |
aacctttatgccgtgattgcggttgcagacagcgatttaaaacattcttttattaataattatgtccttccttttgtcatgttcaattacataaaatttc |
44542536 |
T |
|
| Q |
118 |
attacatcgttaacttgtgtcaattgttgcagttgtttgacatccaatgagtgcaccaagacaattagttcctttga |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44542535 |
attacatcgttaacttgtgtcaattgttgcagttgtttgacatccaatgagtgcaccaagacaattagttcctttga |
44542459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University