View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11903_low_7 (Length: 438)
Name: NF11903_low_7
Description: NF11903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11903_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 407; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 407; E-Value: 0
Query Start/End: Original strand, 1 - 427
Target Start/End: Original strand, 15513769 - 15514195
Alignment:
| Q |
1 |
cctctctacacaactttttcataatcagcaaataatctaagtgaaattactacgtatattctctctatctcaagcaagctccatggccaataattacccc |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15513769 |
cctctctacacaactttttaataatcagcaaataatccaagtgaaattactacgtatattctctctatctcaagcaagctccatggccaataattacccc |
15513868 |
T |
 |
| Q |
101 |
attgatcagatcaacgccttatataagatggggaagataaactccctctttggattggcaacatgtcttttattgataccaatctcagttttttcatcat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | |||||||||||||||||||| |
|
|
| T |
15513869 |
attgatcagatcaacgccttatataagatggggaagataaactccctctttggattggcaacatgtcttttcttgatgcaaatctcagttttttcatcat |
15513968 |
T |
 |
| Q |
201 |
cagaatcaaattgtcttcccaaatcaaacattttcatgttcacaggttggtcatgctgttgtttcgatttgaccgccaccctcgcgatgtgcctcatgtc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15513969 |
cagaatcaaattgtcttcccaaatcaaacattttcatgttcacaggttggtcatgctgttgtttcgatttgaccgccaccctcgcgatgtgcctcatgtc |
15514068 |
T |
 |
| Q |
301 |
aaccttcttcatccacgaagaaaaccagataagcaggttcgccttacgcctcggtatgctgttatgtggtgctggatttgtctccggctgcttcttcttc |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15514069 |
aaccttcttcatccacgaagaaaaccagataagcaggttcgccttacgcctcggtatgctgttatgtggtgctggatttgtctccggctgcttcttcttc |
15514168 |
T |
 |
| Q |
401 |
ctcattgcgctttgcaatgtcattctt |
427 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
15514169 |
ctcattgcgctttgcaatgtcattctt |
15514195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University