View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11905_high_15 (Length: 238)
Name: NF11905_high_15
Description: NF11905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11905_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 14 - 226
Target Start/End: Complemental strand, 38928820 - 38928608
Alignment:
| Q |
14 |
atgaatgtctaattaaccatgctatgtcattaaaatcaaccttggggtcagtttatcttttctctttgcataaccattactttatcatgccacatatata |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38928820 |
atgaatgtctaattaaccatgctatgtcattaaaatcaaccttggggtcagtttatcttttctctttgcataaccattactttatcatgccacatatata |
38928721 |
T |
 |
| Q |
114 |
ggaaaattgtaatatgacattttgacttagtcaagtcaatgttggagtcttttagactaattaaacattatctaattcccatttaaacttgatagtcatc |
213 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| |||||||||||| |
|
|
| T |
38928720 |
ggaaaattgtaatatgaccttttgacttagtcaagtcaatgttggagtcttttagactaattaaacattatccaattcctatttaaatttgatagtcatc |
38928621 |
T |
 |
| Q |
214 |
tcttctatcaatc |
226 |
Q |
| |
|
||||||||||||| |
|
|
| T |
38928620 |
tcttctatcaatc |
38928608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University