View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11905_low_11 (Length: 250)
Name: NF11905_low_11
Description: NF11905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11905_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 46434173 - 46434430
Alignment:
| Q |
1 |
caaccatgggaatccacatcagcgagaagacacatatttcacagatatactatatcgtttataaacttagacatgcttaaagttgcattttaaatttcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46434173 |
caaccatgggaatccacatcagcgagaagacacatatttcacagatatactatatcgtttataaacttagacatgcttaaagttgcattttaaatttcat |
46434272 |
T |
|
| Q |
101 |
caatagatactttgtaaaatctatagctttgccta--------------tatggactttgcctatatggatcacttcagaggttaggccaggagtatgat |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||| || | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46434273 |
caatagatactttgtaaaatctatagctttttttactaacggtaatgttgaaggactttgcctatatggatcacttcagaggttaggccaggagtatgat |
46434372 |
T |
|
| Q |
187 |
gctagtgtatacttttctg-------gcattaaatgtttcaattgaacctgactatct |
237 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
46434373 |
gctagtgtatacttttctggcttgctgcattaaatgtttcaattgaacctgactatct |
46434430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University