View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11905_low_15 (Length: 240)
Name: NF11905_low_15
Description: NF11905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11905_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 28505969 - 28505747
Alignment:
| Q |
1 |
ttttactttcatcttttttatacttctctagtgtttataaaaagtcatggatttcaccaagtttagattgcattaaagggtggtcctcattgctttcgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28505969 |
ttttactttcatcttttttatacttctctagtgtttataaaaagtcatggatttcaccaagtttagattgcattaaagggtggtcctcattgctttcgct |
28505870 |
T |
 |
| Q |
101 |
agcaattccaacttgcgtttcggtttgtctcgaatggtggtggtatgagttcatgataatgatgtgtggacttttggttaatccaaaagcaacaattgct |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28505869 |
agcgattccaacttgcgtttcggtttgtctcgaatggtggtggtatgagttcatgataatgatgtgtggacttttggttaatccaaaagcaacaattgct |
28505770 |
T |
 |
| Q |
201 |
tcaatgggaatacttattcaaac |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
28505769 |
tcaatgggaatacttattcaaac |
28505747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 100 - 145
Target Start/End: Original strand, 2990369 - 2990414
Alignment:
| Q |
100 |
tagcaattccaacttgcgtttcggtttgtctcgaatggtggtggta |
145 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
2990369 |
tagcaattccaagctgcatttcggtttgtctcgaatggtggtggta |
2990414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 117 - 223
Target Start/End: Original strand, 51874979 - 51875085
Alignment:
| Q |
117 |
gtttcggtttgtctcgaatggtggtggtatgagttcatgataatgatgtgtggacttttggttaatccaaaagcaacaattgcttcaatgggaatactta |
216 |
Q |
| |
|
||||| |||||| | ||||||||||||||||| |||||||||| |||||||||||||||| || ||||| |||| ||| |||||||||| || |||| |
|
|
| T |
51874979 |
gtttctgtttgtttagaatggtggtggtatgaactcatgataattttgtgtggacttttggtcaacccaaagtcaaccatttcttcaatgggtattctta |
51875078 |
T |
 |
| Q |
217 |
ttcaaac |
223 |
Q |
| |
|
||||||| |
|
|
| T |
51875079 |
ttcaaac |
51875085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University