View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11907_high_20 (Length: 289)
Name: NF11907_high_20
Description: NF11907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11907_high_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 15 - 175
Target Start/End: Complemental strand, 31431511 - 31431354
Alignment:
| Q |
15 |
agacaccctcaccctgcttgagtctgaaagagaagcaagaaggttgcgctagagaaactcagcggtttggtctggtgcaggattcaataaacatttgttt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31431511 |
agacaccctcaccctgcttgagtctgaaagagaagcaagaaggttgcgctagagaaactcagcggtttggtctggtgcaggattcaataaacatttgttt |
31431412 |
T |
 |
| Q |
115 |
tttggggattatttagtagaagatgtcaaatgttattgtcaaacacttcaattttgcacct |
175 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31431411 |
tttggggattatttagt---agatgtcaaatgttattgtcaaacacttcaattttgcacct |
31431354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 232 - 280
Target Start/End: Complemental strand, 31431313 - 31431265
Alignment:
| Q |
232 |
gatatgcaacttctttattctctaaaatatgtgctggcttaaatctcat |
280 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31431313 |
gatatgcaacttctttatactctaaaatatgtgctggcttaaatctcat |
31431265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 79; Significance: 6e-37; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 15 - 132
Target Start/End: Original strand, 2341701 - 2341816
Alignment:
| Q |
15 |
agacaccctcaccctgcttgagtctgaaagagaagcaagaaggttgcgctagagaaactcagcggtttggtctggtgcaggattcaataaacatttgttt |
114 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| ||| |||||||||||| ||||| |
|
|
| T |
2341701 |
agacaccctcaccctacttgagtctgaaagagaagcaagaaggttgcgctagagaaactca--ggtttggtgtggtacagcattcaataaacaaatgttt |
2341798 |
T |
 |
| Q |
115 |
tttggggattatttagta |
132 |
Q |
| |
|
|||||| ||||||||||| |
|
|
| T |
2341799 |
tttgggaattatttagta |
2341816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 43 - 85
Target Start/End: Complemental strand, 37397900 - 37397858
Alignment:
| Q |
43 |
agagaagcaagaaggttgcgctagagaaactcagcggtttggt |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
37397900 |
agagaagcaagaaggttgcgctagagaaactcaacggtctggt |
37397858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University