View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11907_high_24 (Length: 249)
Name: NF11907_high_24
Description: NF11907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11907_high_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 1675118 - 1675359
Alignment:
| Q |
1 |
aacaaaccctagcgtttccgctaatcttgctcaatctgaattaccttctaaaccgggaaattcagaatctcaagaagttggaactgagtattacaatgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1675118 |
aacaaaccctagcgtttccgctaatcttgctcaatctgaattaccttctaaaccgggaaattcagaatctcaagaagttggaactgagtattacaatgct |
1675217 |
T |
|
| Q |
101 |
ggacgcggtcgtggtagaggacgcggctgtggaagaggaaggggccgatcgaattcgaatcgtcttcagtgtcaaatttgtgctagaaacaaccatgatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1675218 |
ggacgcggtcgtggtagaggacgcggccgtggaagaggaaggggccgatcgaattcgaatcgtcttcagtgtcaaatttgtgctagaaacaaccatgatg |
1675317 |
T |
|
| Q |
201 |
ctgctcgctgctggtttcgttatgatcaagctagttcttctc |
242 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1675318 |
ctgctcgctgctgttttcgttatgatcaagctagttcttctc |
1675359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 45494358 - 45494599
Alignment:
| Q |
1 |
aacaaaccctagcgtttccgctaatcttgctcaatctgaattaccttctaaaccgggaaattcagaatctcaagaagttggaactgagtattacaatgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45494358 |
aacaaaccctagcgtttccgctaatcttgctcaatctgaattaccttctaaatcgggaaattcagaatctcaagaagttggaactaagtattacaatgct |
45494457 |
T |
|
| Q |
101 |
ggacgcggtcgtggtagaggacgcggctgtggaagaggaaggggccgatcgaattcgaatcgtcttcagtgtcaaatttgtgctagaaacaaccatgatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45494458 |
ggacgcggtcgtggtagaggacgcggccgtggaagaggaaggggccgatcgaattcgaatcgtcttcagtgtcaaatttgtgctagaaacaaccatgatg |
45494557 |
T |
|
| Q |
201 |
ctgctcgctgctggtttcgttatgatcaagctagttcttctc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45494558 |
ctgctcgctgctggtttcgttatgatcaagctagttcttctc |
45494599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University