View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11907_high_27 (Length: 240)
Name: NF11907_high_27
Description: NF11907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11907_high_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 38932061 - 38931845
Alignment:
| Q |
1 |
taaatgcaaccaactttgttatatataaatgattcannnnnnnattcatgtcatgtcatgtagagattttatctagctgggaatccagtaaaacagagtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| || || |||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38932061 |
taaatgcaaccaactttgttatatataaatcattcattt-----tttat-tcatgtgatgtagagattttatctagctgggaatccagtaaaacagagtg |
38931968 |
T |
 |
| Q |
101 |
gtagaaagcgtggtgataaagaagaagaaactaacaacatgttcagtggttttgattcacgtttcttgggacaagttttgaaagtgaaagaaagtataat |
200 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38931967 |
gaagaaagcgtggtgataaagaagaagaaactaacaacatgttcagtggttttgattcacgtttcttgggacaagttttgaaagtgaaagaaagtataat |
38931868 |
T |
 |
| Q |
201 |
tagaaagcttcaatctccagatg |
223 |
Q |
| |
|
||||||||||||||||| ||||| |
|
|
| T |
38931867 |
tagaaagcttcaatctcaagatg |
38931845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University