View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11907_high_31 (Length: 226)
Name: NF11907_high_31
Description: NF11907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11907_high_31 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 28243423 - 28243638
Alignment:
| Q |
1 |
tgagtctcttttcttaatctctgtttgatcactctttctcaaaactttatagcatgattcataagtttgatcagctataatttgcacaatttcgtgtaca |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28243423 |
tgagtctcttttcttaatctctgttagatcactctttctcaaaactttatagcatgattcataagtttgatcagctataatttgcacaattttgtgtaca |
28243522 |
T |
|
| Q |
101 |
ctgttattcttatagatcagaattaaaattctttttctccactcgtcacatttagactattgtcatgtttcaatgcccttatctaattaatcttgtggat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28243523 |
ctgttattcttatagatcagaattaaaattctttttctccactcgtcacatttagactattgtcatgtttcaatgcccttatctaattaatcttgtggat |
28243622 |
T |
|
| Q |
201 |
gcatcaccttcctttg |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
28243623 |
gcatcaccttcctttg |
28243638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University