View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11907_low_26 (Length: 242)
Name: NF11907_low_26
Description: NF11907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11907_low_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 26 - 228
Target Start/End: Original strand, 10348546 - 10348748
Alignment:
| Q |
26 |
gtagtaacacaatttattaaaatataaagaacaaaattatattttgaaaagttgtgtcaagatttgtataaagatagcgttttacttagtccnnnnnnna |
125 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
10348546 |
gtagtaacaaaatttattaaaatataaagaacaaaattatattttgaaaagttatgtcaagatttgtataaagatagcgttttacttagtccttttttta |
10348645 |
T |
 |
| Q |
126 |
attaaacatgttatagtgtggaatattcatcaattttgttgatgattaatctctatggacaaagttggctggtcacttttaatgagtcttttgttttaat |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
10348646 |
attaaacatgttatagtgtggaatattcatcaattttattgatgattaatctctatggacaaatttgggtggtcacttttaatgggtcttttgttttaat |
10348745 |
T |
 |
| Q |
226 |
cat |
228 |
Q |
| |
|
||| |
|
|
| T |
10348746 |
cat |
10348748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University