View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11907_low_28 (Length: 240)
Name: NF11907_low_28
Description: NF11907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11907_low_28 |
 |  |
|
| [»] chr5 (4 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 1e-96; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 25863671 - 25863449
Alignment:
| Q |
18 |
atagcaagtgatccaactccaccatggccttatgtgggaggttccttacacgcactagacaatgcatttttgtgggctgagtaagtccacaaattaaatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
25863671 |
atagcaagtgatccaactccaccatggccttatgtgggaggttcattgcacgcactagacaatgcatttttgtgggctgagtatgtccacaaactaaata |
25863572 |
T |
 |
| Q |
118 |
agattatttttctagtaatttgcctatgatgatattagggttaatgatgatgtatttgcagaaaatatggattgaaagtgatgattgatcttcatgcagc |
217 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||| ||||||||||| | ||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25863571 |
agattttttttcaagtaatttgcctatgatgatattatggttaatgatgttctatctgcagaaaatatggattgaaagtgatgattgatcttcatgcagc |
25863472 |
T |
 |
| Q |
218 |
acctgattctcaaaatggctatg |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
25863471 |
acctgattctcaaaatggctatg |
25863449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 18 - 82
Target Start/End: Complemental strand, 25814665 - 25814601
Alignment:
| Q |
18 |
atagcaagtgatccaactccaccatggccttatgtgggaggttccttacacgcactagacaatgc |
82 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||| || ||||||||||||||||| |
|
|
| T |
25814665 |
atagcaagtgacccaactccaccatggccttatgttggaggttctttgcacgcactagacaatgc |
25814601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 174 - 237
Target Start/End: Complemental strand, 25813832 - 25813769
Alignment:
| Q |
174 |
tgcagaaaatatggattgaaagtgatgattgatcttcatgcagcacctgattctcaaaatggct |
237 |
Q |
| |
|
||||| ||||||||||||||| | || |||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
25813832 |
tgcaggaaatatggattgaaaatcattattgatcttcatgctgcacctggttctcaaaatggct |
25813769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 18 - 61
Target Start/End: Complemental strand, 25789114 - 25789071
Alignment:
| Q |
18 |
atagcaagtgatccaactccaccatggccttatgtgggaggttc |
61 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
25789114 |
atagctagtgacccaactccaccatggccttatgttggaggttc |
25789071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University