View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11908_high_3 (Length: 246)

Name: NF11908_high_3
Description: NF11908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11908_high_3
NF11908_high_3
[»] chr7 (1 HSPs)
chr7 (25-246)||(39304724-39304946)


Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 25 - 246
Target Start/End: Original strand, 39304724 - 39304946
Alignment:
25 ttctgttttttatatgaattgaaaa-tgttttgattggtgttcatatccttcattgtgtttaatattgatcttcatgcaatgatatagttatgtttatga 123  Q
    ||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
39304724 ttctgttttttatatgaattgaaaaatgttttgattggtgtccatatccttcattgtgtttaatattgatcttcatggaatgatatagttatgtttatga 39304823  T
124 gaacgttgtaaacattttgacgtccttaagcttgatgatgggagcatggctatgacatggtagagtaagtttttctcagggggtggtaagagtatgatag 223  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
39304824 gaacgttgtaaacattttgacgtccttaagcttgatgatgggagcatggctatgacatggtagagtaagtttttctgagggggtggtaagagtatgatag 39304923  T
224 atttaatcttattcgatcattaa 246  Q
    ||||| |||||||||||||||||    
39304924 atttactcttattcgatcattaa 39304946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University