View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11908_low_1 (Length: 266)
Name: NF11908_low_1
Description: NF11908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11908_low_1 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 16 - 266
Target Start/End: Complemental strand, 38932302 - 38932052
Alignment:
| Q |
16 |
atgaagagccacaatgggaaaaaggaggaaggccacaacaaccacaggatcgtcaccagaaggttcgttatgtgaaacagggtgaccttattgctattcc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38932302 |
atgaagagccacaatgggaaaaaggaggaaggccacaacaaccacaggatcgtcaccagaaggttcgttatgtgaaacagggtgaccttattgctattcc |
38932203 |
T |
|
| Q |
116 |
acctggtgttccttactggacctacaattacggcaataccccgcttattattgtcactctcctcgacacttccaataaactaaaccaactcgatcgtatc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38932202 |
acctggtgttccttactggacctacaattacggcaatacccctcttattattgtcactctcctcgacacttccaataaactaaaccaactcgatcgtatc |
38932103 |
T |
|
| Q |
216 |
ccaagagtaagcaacattaattataatctaacaattactcctaaatgcaac |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38932102 |
ccaagagtaagcaacattaattataatctaacaattactcctaaatgcaac |
38932052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University