View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11908_low_2 (Length: 249)
Name: NF11908_low_2
Description: NF11908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11908_low_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 18 - 231
Target Start/End: Original strand, 31727721 - 31727934
Alignment:
| Q |
18 |
ctagtagtctaccatgtcttattggttttatgccaatttgatgatgagttactgattttttgtgtttttggaatgaaccattgggttatttatcagatca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31727721 |
ctagtagtctaccatgtcttattggttttatgccaatttgatgatgagttactgattttttgtgtttttggaatgaaccattgggttatttatcagatca |
31727820 |
T |
|
| Q |
118 |
cgaagcatttttactcatcaaagggtgagtgggagaacttgactagagatctgaaggagatctaatgttgaatggtgcctatttcacaccgtctgaagcg |
217 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |||| ||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
31727821 |
cgaagcatttttactcatcaaaaggtgagtgggagaactggactggagatctgaaggagatctaatattgaatggtgcctatttcacaccgtctggagcg |
31727920 |
T |
|
| Q |
218 |
ggagcatcttcttc |
231 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
31727921 |
ggagcatcttcttc |
31727934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 70 - 231
Target Start/End: Original strand, 39082941 - 39083103
Alignment:
| Q |
70 |
tgattttttgtgtttttggaatgaaccattgggttatttatcagatcacgaagcatttttactcatcaaagggtgagtgggagaacttg-actagagatc |
168 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | | |||||| |
|
|
| T |
39082941 |
tgattttatgtgtttttggaatgaaccattgggttatttatcagatcacgaagcatttttactcatcaaagggtgagtgggagaactggaattggagatc |
39083040 |
T |
|
| Q |
169 |
tgaaggagatctaatgttgaatggtgcctatttcacaccgtctgaagcgggagcatcttcttc |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
39083041 |
tgaaggagatctaatgttgaatggtgcctacttcacaccgtctggagcgggagcatcttcttc |
39083103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University