View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11908_low_3 (Length: 246)
Name: NF11908_low_3
Description: NF11908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11908_low_3 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 25 - 246
Target Start/End: Original strand, 39304724 - 39304946
Alignment:
| Q |
25 |
ttctgttttttatatgaattgaaaa-tgttttgattggtgttcatatccttcattgtgtttaatattgatcttcatgcaatgatatagttatgtttatga |
123 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39304724 |
ttctgttttttatatgaattgaaaaatgttttgattggtgtccatatccttcattgtgtttaatattgatcttcatggaatgatatagttatgtttatga |
39304823 |
T |
|
| Q |
124 |
gaacgttgtaaacattttgacgtccttaagcttgatgatgggagcatggctatgacatggtagagtaagtttttctcagggggtggtaagagtatgatag |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39304824 |
gaacgttgtaaacattttgacgtccttaagcttgatgatgggagcatggctatgacatggtagagtaagtttttctgagggggtggtaagagtatgatag |
39304923 |
T |
|
| Q |
224 |
atttaatcttattcgatcattaa |
246 |
Q |
| |
|
||||| ||||||||||||||||| |
|
|
| T |
39304924 |
atttactcttattcgatcattaa |
39304946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University