View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11909_high_15 (Length: 342)
Name: NF11909_high_15
Description: NF11909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11909_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 15 - 228
Target Start/End: Complemental strand, 12185859 - 12185646
Alignment:
| Q |
15 |
atgaacatgcagtcattatattgtggaaattgatgcgttgttggaaggtgttgctgcccgccataaagaaatatcaatggcaatcggagccaattgctgc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12185859 |
atgaacatgcagtcattatattgtggaaattgatgcgttgttggaaggtgttgctgcccgccataaagaaatatcaatggcaatcggggccaattgctgc |
12185760 |
T |
 |
| Q |
115 |
tgggaccaaatatatagatagggactgcatcaagagccaagaaagaaacacagtattcgactttttgtcatcgacaattacaaagagtgaagtctctacc |
214 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12185759 |
tgggaccaaatatatggatagggactgcatcaagagccaagaaagaaacacagtattcgactttttgtcatcgacgattacaaagagtgaagtctctacc |
12185660 |
T |
 |
| Q |
215 |
aaatctattcaacc |
228 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
12185659 |
aaatctattcaacc |
12185646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 34 - 216
Target Start/End: Complemental strand, 12191378 - 12191204
Alignment:
| Q |
34 |
attgtggaaattgatgcgttgttggaaggtgttgctgcccgccataaagaaatatcaatggcaatcggagccaattgctgctgggaccaaatatatagat |
133 |
Q |
| |
|
||||||||||||||||| ||||||||||| || |||||||||||||||||| ||||||||||| | || | ||| |||| ||||||||| | |
|
|
| T |
12191378 |
attgtggaaattgatgcattgttggaaggcgtctctgcccgccataaagaaagatcaatggcaaaccaagtcgatttctgccgggaccaaaga------- |
12191286 |
T |
 |
| Q |
134 |
agggactgcatcaagagccaagaaagaaacacag--tattcgactttttgtcatcgacaattacaaagagtgaagtctctaccaa |
216 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||||||| || ||||||| |||||||||||||||||||||||||| |
|
|
| T |
12191285 |
---gactgcatcaagagccaagaaagaaacgcataatattcgactttctgccatcgacgattacaaagagtgaagtctctaccaa |
12191204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University