View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11909_low_23 (Length: 258)

Name: NF11909_low_23
Description: NF11909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11909_low_23
NF11909_low_23
[»] chr8 (2 HSPs)
chr8 (17-125)||(43064249-43064357)
chr8 (165-235)||(43064363-43064433)


Alignment Details
Target: chr8 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 17 - 125
Target Start/End: Original strand, 43064249 - 43064357
Alignment:
17 acaagactgaatgatgtcgagagagacaagtgagaatggaatttctattgaatcaat-ggatgttcagagttgaaaagttgaaacgatggagtgatattg 115  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||    
43064249 acaagagtgaatgatgtcgagagagacaagtgagaatggaatttctattgaatcaatgggatgttcagagttgaaaagttgaaacgatggagt-atattg 43064347  T
116 aattaaaatg 125  Q
    ||||||||||    
43064348 aattaaaatg 43064357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 165 - 235
Target Start/End: Original strand, 43064363 - 43064433
Alignment:
165 aaatgagattattatgtgagatgagcatcattttaattaattaaagaaacacaacattggtgtggcctacc 235  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43064363 aaatgagattattatgtgagatgagcatcattttaattaattaaagaaacacaacattggtgtggcctacc 43064433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University