View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11910_high_15 (Length: 244)
Name: NF11910_high_15
Description: NF11910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11910_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 59 - 224
Target Start/End: Complemental strand, 43515903 - 43515738
Alignment:
| Q |
59 |
ccttaagataagatcaagtaagtgtacgtttgctatatgtttgttccttcttctgcttatatttcatgtgtattgctattattcactgttgcttgcttgt |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43515903 |
ccttaagataagatcaagtaagtgtacgtttgctatatgtttgttccttcttctgcttatatttcatgtgtattgctattattcactgttgcttgcttgt |
43515804 |
T |
 |
| Q |
159 |
ccatcataacgtgtgaggacaatctccaaccaaggatgtacgtatgtaattagtagtagtaatagt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43515803 |
ccatcataacgtgtgaggacaatctccaaccaaggatgtacgtatgtaattagtagtagtaatagt |
43515738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University