View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11910_high_9 (Length: 291)
Name: NF11910_high_9
Description: NF11910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11910_high_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 17 - 278
Target Start/End: Complemental strand, 432078 - 431826
Alignment:
| Q |
17 |
tacctagtggaagaaattgctttgcattcatgtgcttggaatgaaactgaggtaccataccaattatcatcagcaactaattctctgacatgcttcttcc |
116 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
432078 |
tacctagtggaagaaattgctttgcat----gtgcttggagtgaaactgaggtacca-----attatcatcagcaactaattctctgacatgcttcttcc |
431988 |
T |
|
| Q |
117 |
cattacttgttgccacggttgcatggttgacgtctggatattgagttgatgagtgatttccccaaatgataacatttttcacatcactaacatcaacatt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
431987 |
cattacttgttgccacggttgcatggttgacgtctggatattgagttgaggagtgatttccccaaatgataacatttttcacatcactaacatcaacatt |
431888 |
T |
|
| Q |
217 |
tagcttctctgagatttggcctaatgctctattatgatcaagtctagttagacatgtgatgt |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
431887 |
tagcttctctgagatttggcctaatgctctattatgatcaagtctagttagacatgtgatgt |
431826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University