View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11910_low_11 (Length: 286)
Name: NF11910_low_11
Description: NF11910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11910_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 9 - 269
Target Start/End: Complemental strand, 33983890 - 33983630
Alignment:
| Q |
9 |
cagaacctgtggagagtcttttattcaaggcaggtttacaggtgaaacggaaaggtggacggtctggtagcaaccctgttgataccccaaacaaagagca |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
33983890 |
cagaacctgtggagagtcttttattcaaggcaggtttacaagtgaaacggaaaggtggactgtctggtagctaccctgttgataccccaaatgaagagca |
33983791 |
T |
 |
| Q |
109 |
gccatccaatgacaaagaagttgatggtaaactgacactccttcactttgattgtgaatctcgtttagtattgtttctgggttctttctttttcacattt |
208 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33983790 |
gccgtccaatgacaaagaagttgatggtaaactgacactccttcactttgattgtgaatctcatttagtattgtttctgggttctttctttttctcattt |
33983691 |
T |
 |
| Q |
209 |
catttacaatttattttaggtgtatctccagaagctgtattttctatcggcttacaagttt |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33983690 |
catttacaatttattttaggtgtatctccagaagctgtattttctatcggcttacaagttt |
33983630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University