View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11910_low_12 (Length: 262)
Name: NF11910_low_12
Description: NF11910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11910_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 4 - 254
Target Start/End: Original strand, 20268857 - 20269107
Alignment:
| Q |
4 |
gatgtgtgtgtattttgtctttaattatttcactattttactagacttaaccaaccataactacaagatggtaacactgttacattcccttaccctgttt |
103 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20268857 |
gatgcgtgtgtattttgtctttaattatttcactattttactagacttaaccaaccataactacaagatggtaacactgttacattcccttaccctgttt |
20268956 |
T |
|
| Q |
104 |
aaannnnnnnnnnnnnnnnnnnnngtttactagtactgtacactttacaacaaagtaatttgatttgatatactttttatctgtcagagaagagatacag |
203 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20268957 |
aaaatatatacactagactatatagtttactagtactgtacactttacaacaaagtaatttgatttgatatactttttatctgtcagagaagagatacag |
20269056 |
T |
|
| Q |
204 |
cgcatcaaagtagccaaccctcagatcccacatcgagaagctttctgtgct |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
20269057 |
cgcatcaaagtagccaaccctcagatcccacatcgagaagctttcagtgct |
20269107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University