View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11911_high_11 (Length: 252)
Name: NF11911_high_11
Description: NF11911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11911_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 4 - 154
Target Start/End: Complemental strand, 11247483 - 11247333
Alignment:
| Q |
4 |
ttttgaataataacaataataataattctttttggaaataaagagtgtcagatgctgaagaagcactaaacaacgtctagactagagatggcaactccca |
103 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||| ||| ||||||||||||||||||| |
|
|
| T |
11247483 |
ttttgaataataacaataataatgattctttttggaaataaagagtgtcagatgctgaagaatgactaaacaacaattagtctagagatggcaactccca |
11247384 |
T |
 |
| Q |
104 |
acagatcaaccaaatgcaaagaaataaattgagcatgacaatgctcataaa |
154 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11247383 |
acaaatcaaccaaatgcaaagaaataaattgagcatgacaatgctcataaa |
11247333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University