View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11911_high_12 (Length: 250)
Name: NF11911_high_12
Description: NF11911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11911_high_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 54263606 - 54263366
Alignment:
| Q |
1 |
aaattcaccttttctgcaatcgcgtccaacgacacatttttatcctgaannnnnnnnnnn-gtgcgtttctagacttccaaatactcctccactagcagg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54263606 |
aaattcaccttttctgcaatcgcgtccaacgacacatttttatcctgaattttttttttttgtgcgtttctagacttccaaatactcctccactagcagg |
54263507 |
T |
|
| Q |
100 |
caaaccaaatttgttcttaaacccaactccgttccttttcctccaatacttactccagagaaataattgagatgagaattgcaattattatgatacacca |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54263506 |
caaaccaaatttgttcttaaacccaactccgttccttttcctccaatacttactccagagaaataattgagatgagaattgcaattattatgatacacca |
54263407 |
T |
|
| Q |
200 |
cactcactctagccatttagccatatccatccacactttag |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54263406 |
cactcactctagccatttagccatatccatccacactttag |
54263366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University