View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11911_low_12 (Length: 252)

Name: NF11911_low_12
Description: NF11911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11911_low_12
NF11911_low_12
[»] chr8 (1 HSPs)
chr8 (4-154)||(11247333-11247483)


Alignment Details
Target: chr8 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 4 - 154
Target Start/End: Complemental strand, 11247483 - 11247333
Alignment:
4 ttttgaataataacaataataataattctttttggaaataaagagtgtcagatgctgaagaagcactaaacaacgtctagactagagatggcaactccca 103  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||  ||||||||||   ||| |||||||||||||||||||    
11247483 ttttgaataataacaataataatgattctttttggaaataaagagtgtcagatgctgaagaatgactaaacaacaattagtctagagatggcaactccca 11247384  T
104 acagatcaaccaaatgcaaagaaataaattgagcatgacaatgctcataaa 154  Q
    ||| |||||||||||||||||||||||||||||||||||||||||||||||    
11247383 acaaatcaaccaaatgcaaagaaataaattgagcatgacaatgctcataaa 11247333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University