View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11912_high_11 (Length: 215)
Name: NF11912_high_11
Description: NF11912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11912_high_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 70; Significance: 1e-31; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 63 - 211
Target Start/End: Complemental strand, 39129203 - 39129058
Alignment:
| Q |
63 |
atgttccagaatgcgacatccgggataacctttgtgacaaagagannnnnnnnnnnnnnnnnnaagaaactggattacccacttctgcaggctgagtaat |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | |||||||| |||||||||||| |
|
|
| T |
39129203 |
atgttccagaatgcgacatccgggataacctttgtgacaaagagacatcatcatcatcat---aagaaactggattcctcacttctgaaggctgagtaat |
39129107 |
T |
 |
| Q |
163 |
tttctctgaccatgatgtgtgccgcttaaagttgaaatgaccatcatca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
39129106 |
tttctctgaccatgatgtgtgccgcttaaaattgaaatggccatcatca |
39129058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 6 - 67
Target Start/End: Original strand, 39128752 - 39128813
Alignment:
| Q |
6 |
ttactactaggtgtttatgattattcttattttcttttatctgatggcaatgtatatatgtt |
67 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39128752 |
ttactaccaggtgtttatgtttattcttattttcttttatctgttggcaatgtatatatgtt |
39128813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 126 - 190
Target Start/End: Original strand, 39495958 - 39496022
Alignment:
| Q |
126 |
aagaaactggattacccacttctgcaggctgagtaattttctctgaccatgatgtgtgccgctta |
190 |
Q |
| |
|
||||||||||||| | |||||||| |||| |||| ||||||||||| ||||||||||||||||| |
|
|
| T |
39495958 |
aagaaactggattcctcacttctgaaggccaagtacttttctctgacgatgatgtgtgccgctta |
39496022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 63 - 104
Target Start/End: Original strand, 39495898 - 39495939
Alignment:
| Q |
63 |
atgttccagaatgcgacatccgggataacctttgtgacaaag |
104 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
39495898 |
atgttccagaactcaacatccgggataacctttgtgacaaag |
39495939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University