View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11913_low_1 (Length: 372)
Name: NF11913_low_1
Description: NF11913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11913_low_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 143 - 370
Target Start/End: Original strand, 54824791 - 54825018
Alignment:
| Q |
143 |
tattaaaattgaagtgtggtatgacactctgtaactgatccagtaactgtctattgttctgtcaactggttcttttttagtatctgacatggttattcat |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54824791 |
tattaaaattgaagtgtggtatgacactctgtaactgatccagtaactgtctattgttctgtcaactggttcttttttagtatctgacatggttattcat |
54824890 |
T |
|
| Q |
243 |
gcgtattgcagatctatttatttcacggtctgtttctattgatgtgagcatgcaacaggttaggttattataatgcagaattttttcatattacattttt |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54824891 |
gcgtattgcagatctatttatttcacggtctgtttctattgatgtgagcatgcaacaggttaggttattataatgcagaattttttcatattacattttt |
54824990 |
T |
|
| Q |
343 |
gcttagttgttggtatgtggtttctctg |
370 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
54824991 |
gcttagttgttggtatgtggtttctctg |
54825018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 1 - 146
Target Start/End: Original strand, 54824615 - 54824760
Alignment:
| Q |
1 |
tcaaataagcaggacaaaatagtaaaattggttgtaaacttgtaatcatgatggggctgatgaaagtcctttctttatgttaacttctcaattaaatctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54824615 |
tcaaataagcaggacaaaatagtaaaattggttgtaaacttgtaatcatgatggtgctgatgaaagtcctttctttatgttaacttctcaattaaatctg |
54824714 |
T |
|
| Q |
101 |
atcatctaaacctttctgctaaaatttgaactcgttattccatatt |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54824715 |
atcatctaaacctttctgctaaaatttgaactcgttattccatatt |
54824760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University