View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11915_high_29 (Length: 295)
Name: NF11915_high_29
Description: NF11915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11915_high_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 18 - 285
Target Start/End: Complemental strand, 27686078 - 27685810
Alignment:
| Q |
18 |
ggatcaacatggaacaactatttggcttgatagaacctcaggtatgaatctgattagtttcaattcactttagtttagatactttatcgaccggaaaaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27686078 |
ggatcaacatggaacaactatttggcttgatagaacctcaggtatgaatctgattagtttcaattcactttagtttagatactttatcgaccggaaaaat |
27685979 |
T |
 |
| Q |
118 |
tacaatggcacgatttgatctcgcaaaatttatcgcaaattcaagcatgcacaaaatatatcattgacatgtaacactaca-nnnnnnncttctgattaa |
216 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
27685978 |
tacaatggcacgatttgatttcgcgaaatttatcgcaaattcaagcatgcacaaaatatatcattgacatgtaacactacattttttttcttctgattaa |
27685879 |
T |
 |
| Q |
217 |
taggaagtgggttcaagtcaaatcgtccatttcgatcgggatactttggcgcttcgattaagcttcatc |
285 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27685878 |
taggaagtggattcaagtcgaatcgtccatttcgatcgggatactttggcgcttcgattaagcttcatc |
27685810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University