View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11915_high_31 (Length: 290)
Name: NF11915_high_31
Description: NF11915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11915_high_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 164 - 271
Target Start/End: Original strand, 5996920 - 5997027
Alignment:
| Q |
164 |
aacattacatcaaacttaaaactttacggtatgacatcaaatatctatcgacaattttggcacttacagttcgaatgaactcaaagatagagcgtattat |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
5996920 |
aacattacatcaaacttaaaactttacggtatgacatcaaatatctaccgacaattttggcacttacaattcgaatgaactcaaagattgagcgtattat |
5997019 |
T |
|
| Q |
264 |
cttcaacc |
271 |
Q |
| |
|
|||||||| |
|
|
| T |
5997020 |
cttcaacc |
5997027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 40 - 106
Target Start/End: Original strand, 5996850 - 5996918
Alignment:
| Q |
40 |
taatttaaatgcaca--gatgacataaaactgcatgtctagatatctctaagtcaaaaccaccgtttaa |
106 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5996850 |
taatttaaatgcacaacgatgacataaaactgcatgtctagatatctctaagtcaaaaacaccgtttaa |
5996918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University