View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11915_high_45 (Length: 201)
Name: NF11915_high_45
Description: NF11915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11915_high_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 18 - 185
Target Start/End: Complemental strand, 4597619 - 4597451
Alignment:
| Q |
18 |
ccacggatttaaaacctcaaccgttcaattattcaatcatatgaaagcatttagcaatcttcgtcaagattccttcttctgcatagatt-ctacgattta |
116 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
4597619 |
ccacgaatttaaaacctcaaccgttcaattattcaatcatatgaaagcatttagcaatcttcgccaagattccttcttctgcatagattcctacgattta |
4597520 |
T |
 |
| Q |
117 |
cttcggtgttgatgaactacaaacaaccctagcttgtataggggaaacaaaagccttcttgttttccct |
185 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4597519 |
ctttggtgttgatgaactacaaacaaccctagcttgtataggggtaacaaaagccttcttgttttccct |
4597451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University