View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11915_low_16 (Length: 470)
Name: NF11915_low_16
Description: NF11915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11915_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 182 - 417
Target Start/End: Original strand, 16162476 - 16162712
Alignment:
| Q |
182 |
tgcagtgtatgttagattatgacatgtttcttttatctttttaatttgtagttgctgatgtctcagttatcttttatgtcttcctctgtgtgtgtgttgt |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
16162476 |
tgcagtgtatgttagattatgacatgtttcttttatctttttaatttgtggttgctgatgtctcagttatcttttatgtcttcccctgtgtgtgtgttgt |
16162575 |
T |
 |
| Q |
282 |
agctgattcaagttgacgtattacttggtgtggtttttgtctgctaccttatgcttggtgttatgattatttgattttaaattgatgtttgccttgaaac |
381 |
Q |
| |
|
||||||||||||||||| | ||| |||||||||||||||||| ||||||| ||||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
16162576 |
agctgattcaagttgacttgttaattggtgtggtttttgtctcctaccttgtgcttggtgttgtgattatttgattttaaattgatgttttccttgaaac |
16162675 |
T |
 |
| Q |
382 |
atttgt-accttgctttaaatttatcttgattttgaa |
417 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
16162676 |
atttgtaaccctgctttaaatttatcttgattttgaa |
16162712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 40 - 134
Target Start/End: Original strand, 16162334 - 16162428
Alignment:
| Q |
40 |
caatccctgtggtatttctcatgggtgatgttgcatgctatgattttggatgggtggcgtgtttgattatttttattgcaagttcatatagattc |
134 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
16162334 |
caatccctgtggtatttctcatgggcgatgttgcatgctatgattttggatgggtggcgtgtttgattattcttattgcaggttcatatagattc |
16162428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University