View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11915_low_21 (Length: 391)
Name: NF11915_low_21
Description: NF11915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11915_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 263; Significance: 1e-146; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 65 - 376
Target Start/End: Original strand, 27897729 - 27898028
Alignment:
| Q |
65 |
actatgtaattttagaccattatgttggactcaagcctagcttatactactataacccctttattaatatggttttctttactattttcttggctaatac |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27897729 |
actatgtaattttagaccattatgttggactcaagcctagcttatactactataacccctttattaatatggtttt------------cttggctaatac |
27897816 |
T |
|
| Q |
165 |
gtatgtcacaaagttggtttaaggatcatcacgtgtacagtgtgccccatacaagtaaaacattttgggtaatgtcggttggggtatgatgcacgtgcgg |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27897817 |
gtatgtcacaaagttggtttaaggatcatcacgtgtacagtgtgccccatacaagtaaaacattttgggtaatgtcggttggggtatgatgcacgtgcgg |
27897916 |
T |
|
| Q |
265 |
gttacactttcaattgacatgcagcttcaattcacaattaggtaggggaaggggagatgtacttgacttgtcaaaattatgaaaattaaatgtcaatgta |
364 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
27897917 |
gttacactttcaattgacatgcagcttcaattcacaattaggtaggggaaggggagatgtacttaacttgtcaaatttatgaaaattaaatgtcaatgta |
27898016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 18 - 69
Target Start/End: Original strand, 27897451 - 27897502
Alignment:
| Q |
18 |
attacatgtgaatattgtttttatatgttttaatcaatttttgattcactat |
69 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
27897451 |
attacatgtgaatattgtttttatatgtctgaatcaatttttgattcactat |
27897502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University