View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11915_low_22 (Length: 384)
Name: NF11915_low_22
Description: NF11915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11915_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 98; Significance: 4e-48; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 12080094 - 12079989
Alignment:
| Q |
1 |
gttgcacatcacaaccatctaactgtagtttgtgttttatgggggtgtggtgtgagttaagagtgtgtgtaagtagtgaagttgaaagtttgtctttttc |
100 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12080094 |
gttgcacagcacaaccatcttactgtagtttgtgttttatgggggtgtggtgtgagttaagagtgtgtgtaagtagtgaagttgaaagtttgtctttttc |
12079995 |
T |
|
| Q |
101 |
caaaga |
106 |
Q |
| |
|
|||||| |
|
|
| T |
12079994 |
caaaga |
12079989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 232 - 314
Target Start/End: Complemental strand, 12079861 - 12079779
Alignment:
| Q |
232 |
gtgtctgtgttttgaaacaatnnnnnnnncaaggagtgatggtagtgtagtttaggagcagcagaaacaagtgctagtgctta |
314 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12079861 |
gtgtctgtgttttgaaacaataaaaaaaacaaggagtgatggtagtgtagtttaggagcagcagaaacaagtgctagtgctta |
12079779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University