View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11915_low_29 (Length: 316)
Name: NF11915_low_29
Description: NF11915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11915_low_29 |
 |  |
|
| [»] scaffold0088 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0088 (Bit Score: 144; Significance: 1e-75; HSPs: 1)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 93 - 300
Target Start/End: Complemental strand, 46357 - 46147
Alignment:
| Q |
93 |
ataggtatcttatacttac---acaccaattctctactctcctcgtacgtagtaaagagaaaactgaactgctttatgaaatactatgttaagcagaggg |
189 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||| ||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46357 |
ataggtatcttatacttactacacaccaattatctgctctcctcgtatgtagcaaagagaaaactgaactgctttatgaaatactatgttaagcagaggt |
46258 |
T |
 |
| Q |
190 |
agtaacctcgttatttataatcggaggtcacttacatttctaatgtattctaataccatattatttaataaatgattttacannnnnnnagggatgctta |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| ||||||| ||| |
|
|
| T |
46257 |
agtaacctcgttatttataatcggaggtcacttacatttctaatgtattataataccttattatttaataaatgattttacatttttttagggatgttta |
46158 |
T |
 |
| Q |
290 |
gataaaaataa |
300 |
Q |
| |
|
||||||||||| |
|
|
| T |
46157 |
gataaaaataa |
46147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University