View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11915_low_32 (Length: 293)

Name: NF11915_low_32
Description: NF11915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11915_low_32
NF11915_low_32
[»] chr8 (1 HSPs)
chr8 (43-90)||(43196144-43196191)


Alignment Details
Target: chr8 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 43 - 90
Target Start/End: Original strand, 43196144 - 43196191
Alignment:
43 aacattatgaaatgccctacttgttcaactgacatagctgattatctt 90  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
43196144 aacattatgaaatgccctacttgttcaactgacatagctgattatctt 43196191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University